Gs-coupled receptor signaling in airway smooth muscle. Gs-coupled receptors on airway smooth muscle [ASM] are activated by endogenous agents such as circulating catecholamines, prostaglandins and iso-prostanes, adenosine and vasoactive intestinal peptide [VIP]. Activated Gαs binds to and activates membrane bound adenylyl cyclase [AC]. AC is comprised of eight membrane-spanning α-helices, and two cytosolic domains which are required for catalytic activity and integrate various regulatory signals. The cytosolic domains possess specific binding sites for the G-protein subunits Gαs, Gαi, and Gβγ. Of the nine know AC isoforms, AC V and VI appear be expressed and functionally important in human ASM. Adenylyl cyclase activation catalyzes the formation of cyclic AMP from cytoplasmic ATP. Cyclic AMP is a ubiquitous second messenger whose principal function is to activate protein kinase A [PKA]. Inactive PKA exists as a complex comprising two regulatory and two catalytic subunits. The high affinity binding of cyclic AMP to domains in the regulatory region induces a conformational change forcing the release of the active catalytic subunits. PKA-mediated phosphorylation of various intracellular proteins has widespread effects in ASM. PKA can phosphorylate certain Gq-coupled receptors as well as phospholipase C [PLC] and thereby inhibit G protein-coupled receptor [GPCR] -PLC-mediated phosphoinositide [PI] generation, and thus calcium flux. PKA phosphorylates the inositol 1,4,5-trisphosphate [IP3] receptor to reduce its affinity for IP3 and further limit calcium mobilization. PKA phosphorylates myosin light chain kinase [MLCK] and decreases its affinity to calcium calmodulin, thus reducing activity and myosin light chain [MLC] phosphorylation. PKA also phosphorylates KCa++ channels in ASM, increasing their open-state probability [and therefore K+ efflux] and promoting hyperpolarization. Through its phosphorylation of the transcription factor CREB and its [typically inhibitory] effects on GPCR and receptor tyrosine kinase signaling, PKA regulates the transcription of numerous genes. Recent studies suggest that cAMP/PKA mediates regulation of the expression of numerous immunomodulatory proteins in ASM including IL-6, RANTES, eotaxin, and GM-CSF [53, 54, 274–276]. Although poorly characterized, the growth inhibitory effect of Gs-coupled receptor activation in ASM is consistent with the known effects of PKA on mitogenic signaling. These effects include inhibition of p42/p44 MAPK signaling via phosphorylation and inhibition of the upstream intermediate raf-1, and via inhibition of promitogenic transcriptional regulation mediated by phospho-CREB. Lastly, Gs-coupled receptor activation is also believed to promote PKA-independent effects, including gating of KCa++ channels directly by Gαs [56], and actin polymerization via an unestablished mechanism [55].
Back to article page
Terms in this set [60]
The lab you work in has discovered a previously unidentified extracellular signal molecule called QGF, a 75,000-dalton protein. You add purified QGF to different types of cells to determine its effect on these cells. When you add QGF to heart muscle cells, you observe an increase in cell contraction. When you add it to fibroblasts, they undergo cell division. When you add
it to nerve cells, they die. When you add it to glial cells, you do not see any effect on cell division or survival. Given these observations, which of the following statements is most likely to be true?
[a] Because it acts on so many diverse cell types, QGF probably diffuses across the plasma membrane into the cytoplasm of these cells.
[b] Glial cells do not have a receptor for QGF.
[c] QGF activates different intracellular signaling pathways in heart muscles,
fibroblasts, and nerve
cells to produce the different responses observed.
[d] Heart muscle cells, fibroblasts, and nerve cells must all have the same receptor
for QGF.
Background/Aims: Signaling of Gs protein-coupled receptors [GsPCRs] is accomplished by stimulation of adenylyl cyclase, causing an increase of the intracellular cAMP concentration, activation of the intracellular cAMP effectors protein kinase A [PKA] and Epac, and an efflux of cAMP, the function of which is still unclear. Methods: Activation of adenylyl cyclase by GsPCR agonists or cholera toxin was monitored by measurement of the intracellular cAMP concentration by ELISA, anti-phospho-PKA substrate motif phosphorylation by immunoblotting, and an Epac-FRET assay in the presence and absence of adenosine receptor antagonists or ecto-nucleotide phosphodiesterase/pyrophosphatase2 [eNPP2] inhibitors. The production of AMP from cAMP by recombinant eNPP2 was measured by HPLC. Extracellular adenosine was determined by LC-MS/MS, extracellular ATP by luciferase and LC-MS/MS. The expression of eNPP isoenzymes 1-3 was examined by RT-PCR. The expression of multidrug resistance protein 4 was suppressed by siRNA. Results: Here we show that the activation of GsPCRs and the GsPCRs-independent activation of Gs proteins and adenylyl cyclase by cholera toxin induce stimulation of cell surface adenosine receptors [A2A or A2B adenosine receptors]. In PC12 cells stimulation of adenylyl cyclase by GsPCR or cholera toxin caused activation of A2A adenosine receptors by an autocrine signaling pathway involving cAMP efflux through multidrug resistance protein 4 and hydrolysis of released cAMP to AMP by eNPP2. In contrast, in PC3 cells cholera toxin- and GsPCR-induced stimulation of adenylyl cyclase resulted in the activation of A2B adenosine receptors. Conclusion: Our findings show that stimulation of adenylyl cyclase causes a remarkable activation of cell surface adenosine receptors.
© 2018 The Author[s]. Published by S. Karger AG, Basel
Introduction
Numerous hormones and neurotransmitters mediate their effects on target cells by binding to G protein-coupled receptors that either stimulate [GsPCR] or inhibit [Gi protein-coupled receptors] the activity of adenylyl cyclase that catalyzes the formation of cAMP from ATP. Alterations of the intracellular cAMP concentration [[cAMP]i] regulate a large number of cellular processes, affecting e.g. the control of various metabolic events, in particular glucose metabolism, muscle contraction, secretion, memory, and immune function [1-3]. cAMP binds to and activates intracellular cAMP effectors, i. e. protein kinase A [PKA], cAMP-dependent Rap-exchange factors [Epacs] and cAMP-gated ion channels [2-4]. A-kinase anchoring proteins [AKAPs] target PKA to specific substrates and distinct subcellular compartments, providing spatial and temporal specificity for mediation of biological effects channeled through the cAMP/PKA pathway [5]. Stimulation of adenylyl cyclase also leads to an efflux of cellular cAMP through multidrug resistance protein 4 [MRP4], which may serve to regulate [cAMP]i signaling following activation of adenylyl cyclase [6-9]. No receptor for extracellular cAMP has been found on mammalian cells. Whether extruded cAMP itself serves as an extracellular signaling molecule in its own right or precursor of an extracellular signaling molecule in mammalian cells is not entirely clear.
P1 purinergic receptors [adenosine receptors] are activated by adenosine and AMP and are important regulators of adenylyl cyclase. Whereas A2A and A2B adenosine receptors couple to G proteins [Gs],which stimulate adenylyl cyclase and thereby increase the levels of intracellular cAMP, A and A3 receptors inhibit adenylyl cyclase activity via Gi proteins [10, 11]. A well-established mode of activation of adenosine receptors occurs under stress conditions such as hypoxia and inflammation and upon stimulation of some G protein-coupled receptors which induce mobilization of intracellular calcium. This involves the release of cellular ATP, which causes activation of P2 purinergic receptors and – after hydrolysis to AMP by CD39 [ectonucleoside triphosphate diphosphohydrolase 1] and further to adenosine by ecto-5-nucleotidases [CD73] or ecto-alkaline phosphatases – of P1 [adenosine] receptors [10-13]. In the brain translocation of adenosine via equilibrative nucleoside transporters [ENTs] represents an additional source of extracellular adenosine [14-17].
Here we investigated if activation of adenylyl cyclase by GsPCRs or cholera toxin [CTx], which directly activates Gs proteins and is thus considered to stimulate adenylyl cyclase independently of GsPCRs, represents an alternative pathway for modulating the release of adenine nucleotides and regulating purinergic signaling. Our data show that activation of adenylyl cyclase causes an elevation in the concentration of extracellular adenosine and activation of Gs protein-coupled adenosine receptors [A2A and A2B adenosine receptors].
Materials and Methods
Cell culture and stimulation
Neuroendocrine PC12 [American Type Culture Collection] and PC3 prostate carcinoma cells [European Collection of Authenticated Cell Cultures] were grown in DMEM containing 5% horse serum and 5% fetal calf serum supplemented with antibiotics [18]. Cells were serum-starved for 4 h prior to their exposure to stimuli [CTx, adenosine, AMP and CGS 21680, LPA, isoproterenol, glucagon [all from Sigma-Aldrich], or PACAP [PACAP38, Calbiochem]], in serum-free DMEM in the presence or absence of inhibitors [ZM 241385 [Tocris], SCH 58261, MRS 1754, S32826, ARL67156, 4-nitrobenzylthioinosine [NBMPR] [all from Sigma-Aldrich] or HA155 [Merck Millipore]].
Suppression of MRP4 expression by siRNA
Control siRNA [AACUGGGUAAGCGGGCGCAtt] or siRNA directed against MRP4 [CCGAGUAGUUCAGCCCAUAtt, 50 nM] were transfected into PC12 cells using the Lipofectamine RNAiMAX reagent in OptiMEM using as described by the manufacturer [Thermo Fisher Scientific]. On the next day the medium was replaced by complete cell culture medium. The cells were used for the experiments 72 h after transfection. Down-modulation of MRP4 expression was monitored by immunoblotting.
Immunoblotting
Immunoblotting of cellular lysates was performed as recently described [18, 19]. For the detection of ecto-nucleotide phosphodiesterase/pyrophosphatase 2 [eNPP2] in the cell culture media the cells grown on six well plates were washed and switched to OptiMEM. After 24 h the supernatants were collected and centrifuged [5 min, 500 g] to remove cell debris. The supernatants were concentrated 10-20-fold using Amicon columns with cut-off of 50 kDa [Millipore].
The blots were probed with antibodies against PKA substrate motif [RXXp[S/T]] [Cell Signalling], MRP4 [Abcam], eNPP2 [GeneTex], Extracellular signal–regulated kinase [ERK] 2 [Santa Cruz Biotechnology] or β-actin [Sigma-Aldrich]. Antigen-antibody complexes were visualized using horseradish peroxidase-conjugated antibodies [BioRad] and the enhanced chemiluminescence system [Pierce] using a Fuji LAS 4000 camera system or by fluorescently labelled secondary antibodies [Leica] using a FLA-9000 image scanner and the software MultiGauge version 3.0 [FujiFilm].
RT-PCR
Total RNA was isolated from PC12 cells with TRIZOL reagent [Sigma-Aldrich] according to the manufacturer’s instructions. cDNA was generated from 1 µg RNA using M-MLV RT polymerase [Promega] and random primer hexamers [Thermo Fisher Scientific]. The reaction was run for 1 h at 37°C. Two µl of the cDNA were used for the PCR reaction using DreamTaq Polymerase [Thermo Fisher Scientific] for amplification of target genes. RNA from rat tissue was used as positive control. The samples were analyzed by DNA gel electrophoresis and staining with ethidium bromide. For the verification the bands were isolated and cloned in the pGEM-T vector [Promega]. The identities of the inserts were verified by sequencing on an GeneAMP® PCR System 9700 [Applied Biosystems].
The following primers were used: eNPP1-for [GAATTCTTGAGTGGCTACAGCTTCCTA], eNPP1-rev [CTCTAGAAATGCTGGGTTTGGCTCCCGGCA], eNPP2-for [CGCTCGAGGCTTTCCAAGAATCCCTC], eNPP2-rev [CTCTAGACTACACTGCCCAGGCCCA], eNPP3-for [AGCCGCCGGTTATCTTGTTCTC], eNPP3-rev [TGATGCCGTGCGACTCTGGATAC] [20].
FRET assay
cAMP sensor, termed TEpacVV, which employs mTurquoise as donor and Venus Venus as acceptor protein was used in the present study [21]. PC12 cells were seeded on 6-well plates coated with Collagen G [Biochrom] and transfected with the plasmid using Lipofectamine LTX [Thermo Fisher Scientific]. After 24 h the cells were seeded on collagen G coated 8-well slides [IBIDI].
Experiments were performed in HEPES-buffered saline [Sigma-Aldrich] at 37°C in a 5% CO2 atmosphere. Images were taken using a Zeiss 510 confocal microscope [Zeiss] using a 40x, 1.3 NA. glycerol immersion objective. Donor excitation was with the 442 nm HeCd laser; donor emission was collected between 450 and 505 nm and acceptor emission between 510 and 600 nm by setting the SP5 spectrometer accordingly. Pictures were taken every 20 seconds over 60 minutes. Pulse duration and the scanning time was 1 second. Agonists and inhibitors were added 90 sec after starting the procedure and generation of the baseline from concentrated stocks. Data from 6–15 cells per experiment are presented as mean ± SD.
cAMP assay
cAMP was extracted from the cells with 0.1 M HCl. To determine [cAMP]e, the medium was mixed with an equal volume of 0.2 M HCl. The subsequent steps for the determination of cAMP were performed by enzyme immuno assay [Cayman Chemicals] as described [18].
ATP assay
Extracellular ATP was determined by a Luciferase-based assay as described by the manufacturer [Thermo Fisher Scientific] using an EnVision apparatus [Perkin Elmer].
Measurement of the degradation of cAMP by recombinant eNPP2 by HPLC analysis
Human recombinant eNPP2 [2 µg] [R&D Systems] was incubated with 2 mM N6-etheno-cAMP [ε-cAMP] [Biolog] in a buffer containing 10 mM CaCl2, 5 mM MgCl2, 0.02% Brij-35 [v/v], 50 mM Tris pH 8.5. Where indicated the autotaxin inhibitor S32826 [100 µM] was added. The enzymatic reaction was run at 37°C in the Agilent auto-sampler. At the beginning every 15 minutes an aliquot was automatically taken and analyzed by an Agilent HPLC 1200 system with a fluorescence detector [Agilent Technologies]. The fluorescence from etheno-derivated adenosine and nucleotides was measured at λex=280 nm and λem=410 nm as previously described [22]. Compound separation was carried out on an Agilent Zorbax XDB-C18 [4.6 x 50 mm; 1.5-µm] column with an upstream connected analytical guard column [4.6 x 12.5 mm; 5-µm [Agilent]. Ten-µl samples were injected by an autosampler and adenine nucleotide/nucleoside analogues were eluted with a flow rate of 0.75 ml/min using a gradient of buffer A [30.5 mM KH2PO4, 5.7 mM tetrabutylammonium hydrogen sulfate [TBAS], pH 5.8, 6% acetonitril] and buffer B [30.5 mM KH2PO4, 5.7 mM TBAS, pH 5.8, 65% acetonitrile]. Initial conditions were 100% eluent A that linearly decreased to 66% within 5.6 min. This condition was maintained for 2.4 min, followed by washing the column with 70% of buffer B for one min and equilibration with 100% buffer A for 4.5 min prior to the next run. External standards of known concentrations were used to determine retention times and to permit sample quantification based on the analysis of peak area. ChemStation Software [Agilent] was used for report and analysis of the data.
Determination of adenosine and ATP by LC-MS/MS
The concentrations of ATP, adenosine and cAMP in the samples were analyzed by liquid chromatography-electrospray ionization-tandem mass spectrometry as previously described [23]. Briefly, the analytes were extracted from 50 µl cell culture supernatant by protein precipitation with methanol and the supernatant was divided in two fractions. One fraction was used for the quantification of ATP, the other one for the analysis of adenosine and cAMP. For the chromatographic analysis of the ATP, an anion exchange HPLC column [BioBasic AX, 150 x 2.1 mm, Thermo] and a 5500 QTrap [Sciex] were used as analyzers, operating as triple quadrupole in positive multiple reaction monitoring [MRM] mode. The analysis of ATP was performed as previously described [23]. Adenosine and cAMP were analyzed using an Atlantis T3 column [100 x 2.1 mm, Waters]. Adenosine was analyzed similarly as described previously [23], cAMP was quantified using 13C5-cAMP as internal standard. The precursor-to-product ion transitions used as quantifier for cAMP was m/z 328.0 → 134.0. Calibration ranges were 5-1, 000 ng/ml for ATP, 1.25 -250 ng/ml for adenosine and 0.5-100 ng/ml for cAMP.
Statistical Analysis
All experiments were performed at least three times independently. Quantitative data are expressed as mean ± standard deviation. Statistical analysis was performed by paired or unpaired Student t tests using the BiAS software for Windows [version 9.11, Epsilon-Verlag]. P values of < 0.05 were considered statistically significant.
Results
Extracellular adenosine and A2 adenosine receptors are involved in GsPCR as well as in cholera toxin [CTx]-induced activation of adenylyl cyclase in PC12 and PC3 cells
Using neuroendocrine PC12 cells as a model system, we initially studied the role of extracellular adenosine and adenosine receptors in the activation of adenylyl cyclase by pituitary adenylyl cyclase-activating peptide [PACAP] and by CTx, which directly stimulates Gs proteins and thus bypasses receptor activation. In these cells, A2A adenosine receptors [A2ARs] are the only functionally relevant adenosine receptors [24]. As expected, adenosine caused an increase in the phosphorylation of PKA substrate motifs, a convenient method to determine PKA activation in situ. This was completely blocked by the addition of adenosine deaminase [ADA, 1 U/ml] [for all online suppl. material, see www.karger.com/doi/ 10.1159/000488270, Fig. S1A and S1B], which scavenges extracellular adenosine, or by the A2AR adenosine receptor [A2AR] antagonists ZM 241385 [10 µM] and SCH 58261 [100 nM] [see online suppl. material, Fig. S1A and S1C]. Remarkably, A2AR blockers and ADA also reduced the increase in [cAMP]i and in PKA substrate motif phosphorylation in response to PACAP [Fig. 1A and 1B] and CTx [200 U/ml] [Fig. 1C-F, [see online suppl. material] Fig. S1D and S1E]. In general, the effects of ADA were smaller than those of A2AR blockers [compare Fig. 1D with 1F].
Fig. 1.
ADA and A2AR antagonists inhibit GsPCR- or CTx-induced increase in [cAMP]i and PKA substrate motif phosphorylation in PC12 cells. [A] Effect of ADA on PACAP-induced adenylyl cyclase activation. Serum-starved PC12 cells were pre-incubated with ADA [1 U/ml] for 5 min, followed by stimulation with 100 nM PACAP or vehicle for the indicated time. The amount of cell-associated cAMP reflecting [cAMP]i was determined by enzyme immunoassay [n=4]. [B] Effect of ADA on PACAP-induced PKA substrate motif phosphorylation. Serum-starved PC12 cells were pre-incubated with ADA [1 U/ml] for 5 min, followed by stimulation with the indicated concentration of PACAP or vehicle for 10 min. The amount of PKA substrate motif phosphorylation was determined by immunoblotting with anti-PKA substrate motif phosphorylation. Protein loading of the lanes was controlled by anti-ERK2 immunoblotting [n=3]. [C] Effect of ADA and SCH 58261 on CTx-induced [cAMP]i. Serum-starved cells were pre-incubated with ADA [1 U/ml] or vehicle for 15 min, followed by stimulation with CTx [200 U/ml] for the indicated time. The amount of intracellular cAMP in the cells was determined as described in [A] [n=3]. [D] Effect of ADA on CTx-induced PKA substrate motif phosphorylation. Serum-starved cells were pre-incubated with ADA [1 U/ml] or vehicle for 15 min, followed by stimulation with CTx [200 U/ml] for the indicated time. The amount of PKA substrate motif phosphorylation in the cells was determined as described in [B]. Band intensities of the whole lane from 4 independent experiments were quantified densitometrically and illustrated as means ± SD [n=4]. [E] Effect of SCH 58261 on CTx-induced [cAMP]i. Serum-starved cells were pre-incubated with SCH 58261 [100 nM] or vehicle for 15 min, followed by stimulation with CTx [200 U/ ml] for the indicated time. The amount of intracellular cAMP was determined as described in [A] [n=4]. [F] Effect of SCH 58261 on CTx-induced PKA substrate motif phosphorylation. Serum-starved cells were pre-incubated with SCH 58261 [100 nM] or vehicle for 15 min, followed by stimulation with CTx [200 U/ml] for the indicated time. The amount of PKA substrate motif phosphorylation in the cells was determined as described in [B] [n=7]. [G] Real-time detection of [cAMP]i by FRET in PC12 cells expressing TEpacVV. Following recording of a baseline with [n=3] or without [n=3] ADA, the cells were stimulated with CTx [200 U/ml]. Values represent means ± SD. Asterisks in the panels A indicate significant differences between the curves at those time points [A, C, E, G] or different conditions [D, lower panel]. *P